CShisMan2_1422


Sequence

>CShisMan2_1422 (3 EST) Length=381 GNAAACTCTCATGCTAGGCAATAATGGTCAGCCTTGTAAGTTCTTCCAACAAGGAGGATGTCGTAACGGTCACTCTTGCA ACTTCATGCACTCTCGATGAGAAATACAACTATTTTCACTGCTGTTTCTTGTCCTTAGCTCTGTAAAAATCACTTAGATT TCGATTTATGCATTTTAATTCAAAAATATCAAACTCTAGCACTACATCACTTAAACTTTACTGGTTGTAAATAAAATGCT AAACGTCTTGTATAGTTTTCTTTTACAATAGAATATTTATTTTATGAATTTCACTATGGGTTTTTAACAAATTACCAGAT TTCATGAATAATTTGTTAATTATGTTCATAAATTGGATTGATGCTTCCCGTTTTCATCTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1422: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236121139713N25365EST000467S. mansoni cDNA
7823821713220AA143815MCCE0110.M1FSchistosoma mansoni, cercariae
12099302330219AA559523MC070510.NA3TBRI-Saber-cercaria-A


Date: 6:41:2 on Sat 25 Nov 117.