CShisMan2_143


Sequence

>CShisMan2_143 (3 EST) Length=587 AAAAATTATGGGGCGGAAATAAAGCGATTTTATATTGCAATCGGTAGACATAATTTATTAGGAGTAAGGAATAAAATAAG TTTACCTGATAATTCGAACCTGAACTTTGTACAAAGGTGGGGTATTAAATATCTCATCCTAAAAATTTCTTGAACTCCAT TCTAGTTTCTAAATCTTGAACAATCAACCGCTACTACCTATTGCAAGTGCTCACTCATGAAGAATTACTGACCACCAATT CAATATATATGTTTAATGTTGGGATGTGCGGTGTCAAAAATCTGATTCTGACACACGGTGTGTTGCGCGCTAACCCCACA AGTGACTACTAGGGCTAGAACACAAGAGCTAGAAAGTGTATTGGACTACCGAATAAAATGCACAAATACTCATTCATACA TATATACAAGTCTATGTTTAGAAAATTTATAGCAACTATCCCTCTACCCAATTTCGATCATGGTTAATTTTTGTTAAACC CTTTTATTAACTTACTTAACACTGTCCTTTGGATAGTAACAAGTCGCATGTGTCTTTGTACTGTTATGATCACTAGAGCA CATGACAGACTAGCCAAAACCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_143: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146503385010AI067043EST208712Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147863385146AI067179EST208851Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155683385928AI067961EST209650Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:2:9 on Tue 21 Nov 117.