CShisMan2_144


Sequence

>CShisMan2_144 (2 EST) Length=590 GGCACGAGCAAGATGATGGTGTTTTGATGTTGGAGGCTCCAGTGAAGGTTGATCAGAACCAGTCGTTGACGCTGAACGAG TCTGGTCAGGTGGCTGTTCGACCGAAATCGGACAATCAGATTAAGGCAGTTCCTGCATCACAAGCTCTTGTTGCGAAAGG TGTTCATGGTCTGTCGTATGTGGATGATGGTTCAGGTGGGAAGCGACTGCATGTTGAAGTTCCAGTGGACCCAGTGTACA AACCTGAAGACTTGTTTGTGAATGTTGACTCGAATCGTGTTGTGGTTAGTGGACGTCATCATAAGCANTTATTAGATCAA CATGGAAGGTCGAGCTCATTCGCAGAGTTCAGTCAGTCGTATGCGATTCCAGAGACAGTTGATCCGTTATCTGTTTCTGC TCAGGTAGTTGGCAATACATTGGTATTGGAGGCGCCACTGGGAGAAGCAACATACCGATTACTCACTAGAAGCCAAAATA ATACGGACTGGATTTTACGATGATTCCTGATGACGAATGATGATGATAATAATGAGGGTGACAATCATCCTTACATGTTT GTGTTAATTTCCGAATAAATATATTTACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_144: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791241702783AA140559MEEG0217.M1FSchistosoma mansoni, egg stage
17533553228030AI014198MEEG0332.M1RSchistosoma mansoni, egg stage


Date: 13:25:57 on Thu 23 Nov 117.