CShisMan2_1442


Sequence

>CShisMan2_1442 (3 EST) Length=421 CTANTTTCTCCCTCCTGTTTTTGTTTATCAGCCATGAAAATGCCCTTCATGCAATAAGGAGGTCTACTTTGCTGAGCGGG TCAATTCACTTGGAAAAAGAACTGGCATCGTCCGTGTTTGAAATGCGAAAAGTGCAAAAAAACGCTGACTGCGGGTTCCC ACTGTGAACATGAAGGTAAACCCTATTGTCAGATNCCATGTTACCAAGCACTGTTTGGACCCAAAGGTTATGGGTCAGTG GCCAGCAGTCACGTCTACAAATAGATAACAAATTTGTCATTTCAAGTTTTGTTTATACATTCTACATGACTACTTTTGAT GTCTCTTGTGAGACAATTCCAATAGATCGCTCCTTCAAGTACTTTTCAATTACTTGGTTTTGATGTTTTAACTTATAAAA TAAACTCGCTGCTTCAAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1442: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641771685493AA125674MLLG0216.M1FSchistosoma mansoni, lung stage
8578141832574AA218481MAAD0146.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
12100232330312AA559616MC080560.NA3TBRI-Saber-cercaria-A


Date: 22:2:11 on Fri 17 Nov 117.