CShisMan2_1460


Sequence

>CShisMan2_1460 (2 EST) Length=292 GAATATAGTAATCTTATTCTAATCACTAAAAGAACAATTGAGAATTGTTGTGATTTAATTTGTTCCTGAAGGACCAGAAG GTGGAAATCAAGCGTTTGTTCAAATTGATCGTTGCAAGATGGTTCCTTCTAAAGAAAAATCTCAATGGGTGTGCATTATG TTGCTAAGGTAAAGTCGCAGTGGGAGCGAATTACAAAATAACGGGCCTTACTCTTTGTCCATCTTTAAGGTCAAGTGACA TTTTAANAGNNNAGGGCGACACGACGGGACAGGGCAGGGCGACGACACAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_1460: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14960542833715AA774379SMTBADA000714SKSchistosoma Lambda Zap II
18698502801779AF042318AF042318Schistosoma Lambda Zap II


Date: 21:30:15 on Fri 24 Nov 117.