CShisMan2_1461


Sequence

>CShisMan2_1461 (2 EST) Length=318 ATGATTGTTTATTACATTTACTAATGTCTAATCCACACATACCACCTTTTCTTGGAATGGATTATCTTTTTTACTAGCAA ATCCTGAAACTCAACAATCTTTATCACGATTCTGTTCCATATACACAATCATTTCTTGTACACATTCAGAGACAGGACGA CGATTTAAATTTGCTTCTTGACGTAATTGTTCAACTAGTTTACGTTGTTGACTTAAAGTTGACATATTTGTATTTTGACT AAACTGTCAACTTTTGTTCAATGATAAATCTGAATTGAATTTAGAATCACAATGTTCCAAATGTGAAAATGAATAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1461: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102231906288AA269220MA1MR043.AA3S. mansoni adult Lambda Zap
15130172854297AA791342SMTBADA000826SKSchistosoma Lambda Zap II


Date: 2:31:41 on Mon 20 Nov 117.