CShisMan2_1463


Sequence

>CShisMan2_1463 (2 EST) Length=289 ATCGTTCGAAACTGCCCAAATAATAATAGCGACACGCTATGCTACAGATGTAATAAATATGGTCACTTCGCGAGAGACTG TACGGAAAGTGGAGGTTCTGGTCCCCAGTGCTATAAGTGCCATGGTTATGGCCATATAGCAAGTCGATGCAATGTGGAGG CGTGAACGAAGTCCCGTGTGAGATGATGCTCAAAGTCGTAGTGCCCGGTACACTTTCGCCCTGCACTCACGACAAGGCGA ATGCATTAAATTGAAATATAAGCTTCCTGATAAATTTTTTCCCGTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1463: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858791377940U58061SMU58061Schistosoma mansoni adult worm Lambda ZAP II library
12102062330495AA559799MC250463.NA3TBRI-Saber-cercaria-A


Date: 2:23:6 on Mon 20 Nov 117.