CShisMan2_147


Sequence

>CShisMan2_147 (3 EST) Length=606 GCGCGCGAACGTGCGCAGAACTTGAGCAACTGTCACGCAAGGCGCGCCAGACGCAGATCTTCATCGAAACGCCGTACCGG AATCAGGCGATGCTCGACAACGCTGGTCGCGACCTGCGCGCCGTCGACGCAAGATCTGCGTCCCGGCCCGATCCTGACCC TCGCGACCGAGACGATCGCGAGCCGAACCGTGACCGACTTGGAAAAAGGCGCCTGCGCGAAATCTGCACAAGCGCCCCGC CAATCTTCCTGCTGCTCGCGAACTGAAGCCGAAACCGGCGAACCGGTGACGCGAGGAGGGCCATTGCGGCCCGCNGCCTG CAAGGTCAAGCGCAGGCTGACCGANTTGCGCCGCCGGCCGTCAGCGCCTTCAATCGCGGCGCCGCCGACGGCCGCGCCGA ACTTGCGCGCGACACGGTTCGTCAGGCTTTCCTTCACCGTGTAGTCGACGAGATCGGGCGCCTTCAGCACGTCGCGGGGC AGCCGTATCGGTCGTGCCCGTAGCCGTCCGCGAAGTCCGAGCTCGACGCTCTTCTCGCCGGTCCAGAACAGGCCCGAGAA CATGTCGGGCAGTCTCGTGCAGCCNGTTGCCGCGGCCATCCTTCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_147: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
60700529730T24127SMEST0325Schistosoma mansoni, adult worm, Gloria Franco
60701529731T24128SMEST0326Schistosoma mansoni, adult worm, Gloria Franco
5137211444974W06754SMEST0390Schistosoma mansoni, adult worm, Gloria Franco


Date: 7:15:19 on Mon 20 Nov 117.