CShisMan2_1475


Sequence

>CShisMan2_1475 (2 EST) Length=366 TTGATGTCCACATATATAAACGTGTATTTACTAATAAATTATGACATATTGAACATAAAAATGTTTGTTTAATTAAATGA TCTAATAATTTATTATTTGTTAATTGTATGTATTTAAACTAATTAATGTATTATCTATATCACTAGTAGTTGTATATCAG TAGTATTAGTAGTAGTATTGGTAGTAGTAGTATGTGATTGTGAAGTCAACCTTAAACATATATGATAATAATTCATATGA CTTGTGTAGATTGACTTATGTAATGATGATTTCATAATTAAATTAAATTAAATTAATTAATTAATTAATGAACAATTAAT TGTATATTATAATGCATAATTGAAAAAAAGAAGAGATATTTACTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_1475: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587332252910AA514106MA2MA118.AA3S. mansoni adult Lambda Zap
11587672252944AA514088MC2NE020.ACSS. mansoni cercarial Lambda Zap


Date: 0:29:37 on Sat 25 Nov 117.