CShisMan2_1482


Sequence

>CShisMan2_1482 (2 EST) Length=287 ACGAAAACGAAGTTATTACCAGTTAACAAATCAACAACAACGACAAAAACACCGGCAGTACTCAGTGAAATATACTTCAC ATAGAAAATCGAAAATATATACAAATTTAAATATGATTCCTGTAAATAGATTACATAAATCATATGTACATATTAGATCT AATACAAGATTAGCTAAAGTTAATCGCCCATATAAATGAACGTCCAATGTGGAAGTATACTTATAAAGTATAATAATAAT AATAATAAGCTATTCATAATAACTTATAATTCTTATAAACATTAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1482: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102131906278AA269210MA1MR033.AA3S. mansoni adult Lambda Zap
9102151906280AA269212MA1MR035.AA3S. mansoni adult Lambda Zap


Date: 2:49:49 on Sat 25 Nov 117.