CShisMan2_1483


Sequence

>CShisMan2_1483 (2 EST) Length=286 GAGGAAATGCCAGTACGGCAACGTCCGGAACGCGATTCACGTCTGCCTGGTGCACATTATCCAAATCCATCTGTTGACGA ACTGCACAGAGTTGGCAATCCTGAAAGTCGGCGTACTGCTGTTAGTCAGTTCAATATGTCAACTAAGGAGAGAATAATCA GACCGAGAACACCTCATGGTTTAGAAATGATCGATTTCAGGAGCCGATCACCTCATGCAGATGTTGACATATTGCCTAAA ATTATTCGCCTTGATCGCGATCAATACCGCAGAGTGAACTACACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1483: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18695173509918AI110948MF002G08.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696683510069AI111099MF001A11.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 9:31:47 on Sun 19 Nov 117.