CShisMan2_150


Sequence

>CShisMan2_150 (6 EST) Length=579 ATGGAGTTTGGATCGTTCGAAAATTTCGCATAATTGGTCAACTATGGTTGAAGGGGTTCAAAGTCATATTGGTTCTTTGA ACTGGGGTTATAAAGTTGCACTAAGAGATAATCAAGTCACGTATCTAAATGCTAAAGGGAGGCTAATAAGCCCTCATGAG GTGCAGATAACAGATAAGAATCAAAAAGTATCTACAATAACTGGAAACAAAATTATCTTAGCTACTGGTGAACGTCCAAA ATACCCAGAAATACCTGGAGCAGTTGAATATGGGATCACAAGTGATGACTTATTTTCTTTGCCATACTTCCCGGGCAAAA CACTAGTCATTGGAGCAAGTTACGTTGCACTGGAATGTGCTGGTTTCCTTGCTAGTTTAGGTGGTGATGTTACCGTTATG GTTCGTTCCATTTTACTTCGTGGTTTTGATCAACAAATGGCTGAAAAGGTTGGTGACTATATGGAGAATCATGGAGTCAA GTTTGCAAAGTTATGTGTACCAGATGAGATCAAACAACTGAAAGTTAGTAGATACTGAAAATAATAAGCCTGGACTTTTG CTTGTTAATGGTCATTATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_150: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148343385194AI067227EST208901Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148633385223AI067256EST208930Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152373385597AI067630EST209313Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153283385688AI067721EST209404Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153593385719AI067752EST209435Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155703385930AI067963EST209652Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 21:5:52 on Fri 24 Nov 117.