CShisMan2_1508


Sequence

>CShisMan2_1508 (2 EST) Length=282 TGCAGGATATTCGGCACGTGCTGAAATTGCACAAACAGCACAAGAAGCTTTATAATAAATTTTTCATAGTTTAGCGCTAC AATCGCTACTGCTTTGTTTCGCTGCAGCATTTTATGTTCTCTGAACATCAATAAGTATAGANCTTCCAAAAGCTTCCAAC TCTGNAAGAAGGTCTAAAATTCTTGAAACCCTGGACCCTAAAGCACTGGAAATATATTATAGAAGAATTGAAATTCCGGT AGATGTTTAAATGTGCGTAAATACATTTCATGTTTTAGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1508: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098062330095AA559399MC250406.NA3TBRI-Saber-cercaria-A
12101572330446AA559750MC140327.NA3TBRI-Saber-cercaria-A


Date: 10:8:33 on Wed 22 Nov 117.