CShisMan2_151


Sequence

>CShisMan2_151 (5 EST) Length=577 CTTCAAAGTAATACAGAAAATCGGCGTCAAAGTGTTTGGTTCAATAATCAAGATGCAGCATATGAACCTGGTGAACGACA GATAGATATTAAATCTGGAATTAAATTATCAAAAAGCCCATCTTTAAGTGTAAAACAGAAGTCTTTTGCTGACAGATTTC ACAAAATAATAAAACCTCGGTCGAATGATAAGTTTCAAAGACCATCTGGTCTAAGAAGACCATCACCCCTTTGTCGAAAT AGCGCAATCACAACAGAATAAGAATATTTAAAATCATATTACCTGCATAATCATGAACTTATAGTACAAATTTTTATAGA TATTGATATTACTTGTCCTCCAGGATATTTTCCTTTTGACACTATCTAATTAAGACNAGTTCAGCTTTTCTTCTATATAA GACTGGTAGATAGAGTTTTTCAAGTGGTATAAACTTCAATTGATAAATACGAACAGGGATCTACTTCTTACGGTTCCAAT ACATTTCCGTGTTAAATGATGTACATTTTTTTCGGATTATGGATGTTAATGAACATGTCTGGGATAAAAAGCAAAACTCA TTCAATCAATTCTATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_151: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694073509808AI111120MF004A02.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695363509937AI110967MF002F02.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695913509992AI111022MF002A03.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696333510034AI111064MF001D11.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696633510064AI111094MF001B04.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 21:19:41 on Sun 19 Nov 117.