CShisMan2_1512


Sequence

>CShisMan2_1512 (3 EST) Length=408 ACTAGGATAAAATGAATATGTATATGTATATATAAATATATATGAAGGAAATTTTAGCAAACTACTCAAATCAGTCAAAA ATTTACTAAAAATAAAAGTGTGAAGTATCAGTCAAACTTATTAAGAGAAGGGCTTGACAACGTGACAGGCGTGTTTATTT AAAGTGCTCACGGTACAATGTACATGATGAAAAGTAACATCGGTCAATTTTTTTTCCTTTTACTGTACTAAATATTAAAA AGAATGATATCAAATCTGATCGGAATGAATAATGTAAGGTAGGAGAAGGCAGTTAAGAATTTAGGCAGGAAAAAATGATA AAATTTTCAACAAATTAAACAATTCATTCTCATTCCATTAGGTTAATATAAGGCATATTAGGAAACTTATAAAGTAAGGT AGAAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1512: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098572330146AA559450MC260439.NA3TBRI-Saber-cercaria-A
17370753189995AA999440MCCE3297.M1FSchistosoma mansoni, cercariae
17371093190029AA999474MCCE3347.M1FSchistosoma mansoni, cercariae


Date: 4:21:17 on Wed 22 Nov 117.