CShisMan2_153


Sequence

>CShisMan2_153 (2 EST) Length=577 GCACGAGGCAGCTGCATGGCATGTTTTTTTTTTTTTTTTTTTTTTTTTTGAGTATTTCACTTTTATTGTTGTATTAACAT ATTGAAAAATATTTTCGAAAAATTATAAAAAGAGCAGCTTATTTCAAAGTTATTATCTGGTAATTTGAATTAGTTTTAAT TTCGTTTGATCAAATTTCCAATGGGAGGAACAGATAACTTAACAGATTCTGAGGATGTGTCATGGGGTTGAACGTTGGAA GGAATACCTGTGTCCCATTTACTTGGTTTCTTCGGTTCTATGTACCCCGTACAAACGGACCCTCCAGATGTTGCACTGGG TTTGTCTGTGCTAGTAATTGGATTTTTAGGTGCATTTGCACTTGTGCTGTTGTTTGCATTCGTTGTATTTGGGTCAGATT TTTTAAGTTCCTTTTGCATTTTCATCAGTCTGTCGATTTCACGATTTTGCACCTTTGCAAGTTCTTCATAGTATGACTGC GGAGTCCAACGATAGGGATCATAAATATCCGTAGAGAAGTTAGTCCCTTTCTCGTCGATTTTCAAAAAATCGATCAGCTT TTCATAAATACTGGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CShisMan2_153: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18149303385290AI067323EST209001Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155873385947AI067980EST209669Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 12:30:2 on Fri 17 Nov 117.