CShisMan2_1535


Sequence

>CShisMan2_1535 (2 EST) Length=346 CTATTAATAAACTAGAATCTACGATAAACTTAAACTACCATAAACATTAACAGTCCACTCTCTCCATCGCCAAACCAACA CCACCGTCTTTGCTCCTGAAACTCATCAACCAACCACTCTTGTCGCCGCCACCGCAGCCGCNACAAAAACTATACTCCCG TCTAGTCAGTACACTCCAACTCAAAAATACACTCGCTCACTCACATCTCTCGATACAACTACACCCTTCTTCACAAGTCC ACTCTCTTCCANTCGGCCAAGACCAACACCACCCGNNTTTTGGTCCTTGAAACCTCAATTAAACCAACCCACTTTTCGGC CGCCGGCAAACCTGGCGGGGCGNGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1535: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826132160070L81207SCMRAP0306ENR2/ENR2 three hour schistosomula worm
14785872804083AA756913MF4MA155.AF3S. mansoni female adult Lambda Zap


Date: 19:36:45 on Mon 20 Nov 117.