CShisMan2_1541


Sequence

>CShisMan2_1541 (5 EST) Length=308 AGGGGTAAATGTTTCATTTAATGGGATTTTNATAAAGGTTCATAAAGAAAGCTGAACATGTATGTTTTTTATGGTGTATA TTAGATAAAATGTTTTATAAATCTAATTTATTGTTAAAATGAGCATTTATAAGGAAGTAGTAAATGAGGAAACCTGATTG AAATTAAAGCTGAATGATTAATTACACAAACATACATAATCATTTGTTGTATATATTCATGCATAATGGTGAATGAGTGA ATAGGTAGGTAGTAAAGCATACAAATATGCCTGTAAAGATGTAATGATCAGATTAGANAAAAAAGCNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1541: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39240514634T14467SMEST0128Schistosoma mansoni, adult worm, Gloria Franco
17370643189984AA999429MCCE3285.M1FSchistosoma mansoni, cercariae
17370663189986AA999431MCCE3287.M1FSchistosoma mansoni, cercariae
17370803190000AA999445MCCE3303.M1FSchistosoma mansoni, cercariae
17371043190024AA999469MCCE3336.M1FSchistosoma mansoni, cercariae


Date: 21:36:39 on Mon 20 Nov 117.