CShisMan2_1543


Sequence

>CShisMan2_1543 (3 EST) Length=278 TTTAAATCTTTCCGGTTTAGTTGGTCTTGGCGACATGTCGGGAGGTAGCAGTGTGCCTGATTCGGCGTTCACTGGTTGGA AATACTATTTTAATTCTTACACCTTGAAAGGCCGTTTTAATGTGAGTTGCATATTAATTCGAAAGTAAAAATAATGTGGA ATTGTTTAAGAAAATATTTTTTAACAATTAGGCGAAAAGTATACATTTCAGCAACATGACGTAAAGTAGAAATGCATTAT ATCACGACGGCAATTGACAAATGAGATTTTTGACGTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_1543: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8248151769666AA185750MAAD0151.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
11529522245787AA508271MAAD0350.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529532245788AA508272MAAD00349.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 13:32:52 on Thu 23 Nov 117.