CShisMan2_155


Sequence

>CShisMan2_155 (4 EST) Length=575 CACGTCGAAACACCTCTAAAAATCGTTCTCTCTCTCGTCGTTCTCGTACTCCTCTATACCGACCCACTTCATCTATCACA AAAGTTTCAGAAGATAATTTGCGAACTCCACCAGAACATCGTCTCGCTCGTCTTGGAGTTGGACCAGTGAGTAAAGATAA TGTATCAGATGGTAGGATGAATAGTCCTTATACAGACTCGAAATCCATTTCCTACATACCAAGCGTCGATGAGACCGTTT CAGCAGCTGTCAATAGAGTTGTGGGTGGCGAGAAATCTAAGTATCGAAAGTCATCACATGAATCTACCACAACGAATAAT AACAATGATAGTAACAATTTAAAATCTATCCACAATTCTAAATCATCTGTTGAACGTAATAGTGATTCACATTCACAACC ACCGTCTTCACCTGGTGTGGTACAGTTAAGTAATAAAACGTCCAGTCCTTCGGTACTCGTGGATATACCACTACCTCAAG ATGCACACCATCAAACCACTGATAATTCAGACAGGAGTCATACGAACAAATCTGTCCCTTATATTGGACCACAAGTTCCT CCGGAACTAGCCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_155: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146093384969AI067002EST208668Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154013385761AI067794EST209478Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155893385949AI067982EST209671Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159503386310AI068343EST210034Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 4:48:47 on Sat 25 Nov 117.