CShisMan2_1550


Sequence

>CShisMan2_1550 (2 EST) Length=422 GCGATTGAAATTCAAATCAAGAAGTTGCAACAACAATCAATTACATTCATCAACTATTAACCAGAGCTTCTGAACAACCA TGGAATAGCAACTGTAGTAGTCCAGAATGCGTTTTCTGTATTTGAATTCCAAGTACGCGTTCGAATGGTTGAATCATTTT ATAAATTTGCATCAGTGTAGAATTTTCAAATTCACATGGAAAAAATGAATCTTCAGGAGGATTTTCAGATTCGATTTGTT TCAAGTAAGCGATCTTAATTGACTTAAATTTCTCAATGGAAGCACGTAACTCTTTGATTGTCNGCTTTATGGTCTGTAAT CTAGATATCATACAATCCACCCGCTTCTCGCGTTTATAAGGNGTTCACGTAACTTGTTATTGACTTCTCGCAGTTGAGCT GCCCGATCTCCTGACAATTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1550: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100541906119AA269087MA1MA022.AA3S. mansoni adult Lambda Zap
15130362854316AA791361SMTBADA000901SKSchistosoma Lambda Zap II


Date: 8:58:54 on Tue 21 Nov 117.