CShisMan2_1554


Sequence

>CShisMan2_1554 (2 EST) Length=281 AACCCGTATCTTGAGGTATAATGATAAAAACTTGAGAAGATAGACAATATCAAAAACACATGAAATTCACCAAGTTTATA AAGTGAATACATTTGGTAGTCATGCTTAAAATTCTTGAACAGAAAGATGAGATATTAGTCTCAAGTCAAAGTTCTTTAGA AAAATGGTTAGAGTATAGTCCCCCTGTTTTCATAGTATCGTCTCAATTAATATCTCATCTAGTCTTCAAACTTTTTTGTA GGGAAAAATTACAACCGGGGCGGTAGGGAATAGTGTCTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1554: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17653753241782AI026168MEEG0404.M1FSchistosoma mansoni, egg stage
17653763241783AI026169MEEG0405.M1FSchistosoma mansoni, egg stage


Date: 12:58:50 on Sun 19 Nov 117.