CShisMan2_156


Sequence

>CShisMan2_156 (3 EST) Length=860 GGTAAATTCGTGAACGCTGATACACCACAAGATAAACATGTAGTTTTAAATGAAATCGAAGTGATGAAAGAATTACATCA TCCGAAATTACTCAACTTACACGAAGCATTCGATGATAAGAATGATGTAGCGATGGTTATGGAACTACTTACTGGTGGTG AATTGTTTGATCGATTAGCAGATGAAAATTCTACAACGTCTGAAGCTGATGCTATTAATTATATTCGACAAGTATGCGAA GGTATACAGCATATGCATGATTCGAATATTATACATCTGGACTTAAAGCCGGAAGATTTGATGTTTGAAACATCAAAATC AAAAAATCTAAAAATTGTTGATTTCAGTTTATCAAGGAAATTAGATCCTAAATCACCAGTCAAAGTTAGTCGATCACATC CAGAATTCGCTGCACCAGAAATTACACGGTCTGAACCAGTTGGATTTTATACAGATATGTGGGCAATAGGAGTTTTGACT TATATGATTTTAAGCGGTTTATCACCTTTTGCTGGAAATACTCCAGCTGAAACAATAGAGAAAATTGCAAGAGGTCAATT CTCATTTGATCATGATGCATTCAATGGAATTTCGGCTAATGGTAAAGATTTTATTAGTAAATTGTTACAAAAACAACCAA ATCAGCGGATGACTATCTATGAAGCCTTGAGACATCCTTGGCTTAACGAAGCAATCACCGACGAACAGCGTCGACGTATT CCACCTTCACGTTATAAAGAATGTCAAAGACAAATGCATGAAAGAATGGGTGAATACATATGAAAGAAGCCCAGCTATTG GCCATTTGGCGAATTATTCATCAATACGTCAAAATAGACGAGATAAATATCGAATACAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_156: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147703385130AI067163EST208834Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152523385612AI067645EST209328Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155583385918AI067951EST209640Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 0:33:1 on Fri 24 Nov 117.