CShisMan2_157


Sequence

>CShisMan2_157 (5 EST) Length=574 CAACACAATTTATCGATTTAAAATAACAAAAAAAATCTGATATAGTAGATAGTAATAATAATGAACGTGATAAGTTTCAA TTATAATTATAGATACTATATAATATAGAAGATAAATCGTATATAAATGGCAACAGTGATGGATTTTGAACTTGTATAGT AATAATAAATACTGTTAAATACTGTGAAACAACAGATTATGTTCAATGATTAAAAAAAAGTAAATCGTGTTAATTGTGTT CATCTCTCTCAAAATCACCTAGAATGGTGTATAAATTGAAGGATAAAGATGATGTTTGCTCTTCACCGAACATAAGTTAT AGAAAAAGCTTAATAATCTTTCCAGGGATGAAATAAAAAATATATATGTAGTTGTAAAGAATAACATCAACTGGTAAACA TGTGAGACGTTTCTCGAATAACTATTCATACTACTTATTACTCAATAATGGTAGTAGTAACTGTTAATGTTGCTGATATC GTTGAAGGAAAATGAGATGTACAGATATAAGGAAAAAAATTAGAATCGAATGCAAATTACATTTTGTAGACATGTTTAAA TAAAAAGAGAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_157: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147693385129AI067162EST208833Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148573385217AI067250EST208924Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150303385390AI067423EST209105Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151073385467AI067500EST209182Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155933385953AI067986EST209675Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 4:0:45 on Sun 19 Nov 117.