CShisMan2_1572


Sequence

>CShisMan2_1572 (8 EST) Length=394 ACGAGTTTTTTTTTTTATGTTAAGCGATTTTATTACAAAGTATACGGTATTAAAATAAAAGAGATAAATAGTAATTAAAT AAATCTATTTCATGTGTCTTGGAAACAGTGTTAATAATGAAAAGTGATCATACGTTTTCGAGATGTTACACTTATGCGTA AAAGTCATCAATGTCTGGAACTGCACCATATCCTCTCGGTCCAAATAGCGTATTATAACAAGGTTCAGTGCAATATAGTC TTCCATCACGTTCTAAGCCACAACCAGGAAGCATGGTTTTATTACATCTGCTGCACTTTAGGCATTGGCGATGCCAGTCA CAACCAAATGAGCTGACCCGCTCAGCAAAGTAAACTTCTCTATCACATCCAGGACACCTCATAGTTTCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_1572: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7823841713222AA143817MCCE0112.M1FSchistosoma mansoni, cercariae
7824481713286AA143881MCCE0269.M1RSchistosoma mansoni, cercariae
12099852330274AA559578MC070593.NA3TBRI-Saber-cercaria-A
12102242330513AA559817MC250498.NA3TBRI-Saber-cercaria-A
16451973056530AA917136SMTBCEA000080SKSchistosoma Lambda Zap II
17368523189772AA999217MCCE0257.M1RSchistosoma mansoni, cercariae
17369693189889AA999334MCCE3154.M1FSchistosoma mansoni, cercariae
17371053190025AA999470MCCE3341.M1FSchistosoma mansoni, cercariae


Date: 6:47:29 on Tue 21 Nov 117.