CShisMan2_158


Sequence

>CShisMan2_158 (7 EST) Length=574 AAGCCAAAAACTGATTTGTATAATTTATTATACACAATGATGACTAAAAACAATTAAAATTGTTCATAAAGAAACCTATG GTATTGCGGTTTGAAGAAAGAAGTGAGGGGGAGAGCTTCGTGATTCAATTGGAAGCTTTTGCTTTTAATGCACTAAATTT CTGGACAACTGGCTGTGTAGCTTGAAGTATATCTTCTGGTAAATTTTTGCTCACTTCCAAACGATGATATAAAACTTGGA GAGTGGGTTGTATACAGACTTGAAGAAGATCCATATTGAACGGTGGTGATACTACTGTACGAATTAACTGGTAGAAATTG TCATCGTTTGTTGACAAAGCTGCATTGCGAAGACAATAATCCACAAAACCGGGAACATGTTGAGAGTCAACAGACTTTAG ATACTCCACTGAAGCGAGAAATTCAGATTTCGTCAATGAATTTCGTGGATTACCAACCAAGAAAGTAAACGGAACTGTTT TGTTATTCTCCAACAAAGTAGAAACTAAGTCACTCAGCCCACGATTAATCAAAACTCCAGCCAACTGTAAACTGACAGAA TTGAGACCAAGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_158: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18152503385610AI067643EST209326Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152593385619AI067652EST209335Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154203385780AI067813EST209497Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154343385794AI067827EST209511Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154713385831AI067864EST209548Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156133385973AI068006EST209695Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157133386073AI068106EST209796Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:34:23 on Mon 20 Nov 117.