CShisMan2_1581


Sequence

>CShisMan2_1581 (2 EST) Length=278 GACTGATCATAGTAATTTATTCTTCAATAAATATAAGTTACATGAGGCATGCCCTATTTTAGTACCAAGGCAAAAATAAA TGGGCAAATATTTTCCGTGGGAATGGGATTGTCTTGTTGGCAAACAAAAAAATATGATTGTTAAAGAAACACGCAGCCGA TAGAAGTAGCAATTTAAGGTCCTCGAGGAAGAATTATGGAGGGGGAATGTATCGTTTCCGGAGACCCGGAAAAATCAAAT CTCAGACAATTTAGAGAACAGTGGGAGATCAAATTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1581: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100302330319AA559623MC090708.NA3TBRI-Saber-cercaria-A
17369853189905AA999350MCCE3181.M1FSchistosoma mansoni, cercariae


Date: 23:47:15 on Fri 17 Nov 117.