CShisMan2_1590


Sequence

>CShisMan2_1590 (3 EST) Length=346 AAAACNATGAACTTTTATTTCTTCNAATTATTGATTACCATCTCATTATTAAGAAAAAGTTTAAGAACTAGATAGATAAA CCAACCAAAAAAAAAAGGAAACGNAGCCAAAAAAATAAACCAACCAACCATAAAAATTNACCAGGAACATTGGCTAGAAG AATATTGAGAAATAATAATAAAGCTAATTAAAGTATATACGTGTATGTGTTAATGATGATAAACGTCGTCATCAGCATCA TCATCATCGTCATATTGAAGCAAGAAATAAACCTAAATGTGAATTTATAAATAACCCATTCATACAGACAACTATTAGCA CAATTACTATTCAATGGTTAGAACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1590: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344389972790L46922SCMRAP009G2/KS adult worm mini-library
7641391685455AA125703MLLG0117.M1FSchistosoma mansoni, lung stage
18151713385531AI067564EST209246Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 13:20:5 on Thu 23 Nov 117.