CShisMan2_1591


Sequence

>CShisMan2_1591 (3 EST) Length=393 CTAAGTCGATTCGTTTCCTACTGCTGCTGCTTTTTGCATCTCCTTCGGCTCGATGTTGTATGATTTCGCTAGTTGGTATA GAAGGTGGCGGTTTGGTGAAGGGAAAACGTATTGATTTAGTTCTAATTGGCCCACCAGGTAGTGGAAAATCGGGACTCAG GCGCTAGTCAAAATAGTCTGAACGTTATAACATCTGCCGATTTATCTACTGGAGACATTCTTAGAGCCATCATAGCATCA GGATCAGAACTTGGTCAAAAAGTACAGAAAATTACGGAATCAGGAGGACTTGTTTCAGACGACATAGTTTGTGACCTAAT CGCACAAAAAATCAATTCTCCTGAATGTAAAAATGGACTTCTATTCGACGGGTTTCCACGCACAATAGGGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1591: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098182330107AA559411MC250423.NA3TBRI-Saber-cercaria-A
16452013056534AA917140SMTBCEA000084SKSchistosoma Lambda Zap II
17533393228014AI014182MEEG0305.M1RSchistosoma mansoni, egg stage


Date: 9:19:20 on Sun 19 Nov 117.