CShisMan2_16


Sequence

>CShisMan2_16 (3 EST) Length=676 GCACGAGCAACTTTGCATCGTCAAGTTAACTTGTGTAGACATCTTTATAAATGCATCAATATTCTTTGTGATCCCAACTT ACACATGTTTGCTCAAATTGCTTCGCCTGCCTCGTCGACCTAGGTTGAAATCCTAAAATTTGAATATCTTCATTACCCAG AAATTCCCCACCAACAATAAAAAGAGCCGGAAGTGATATTTTTGTCAACTGAGCGGTTAACTTTACCGTTAATGTCATTT TTTACTGGATTGTAAACTGAAACCAATGTTTCTTTTGTAAATCTCTATCCAGTGTGACGGAAAGCCTTCGTTTCAACAGT TCTATCACCTTGTACATATTAAGACATCTGGCCTTAGATATGGCGTGGACGATGAATCGAGTAAATTTGGCCGTAAACAA TAACCATAGTCGTTATTTGATACACTGCAAAAATTATTTAAAAGAAGTTTTAAGTTCAGGAGTACTGGGTGCTGAGGCAG CCTCACTAGATATAATTGAACTTATACCTGGAGACAAGTATGCCAAAATTGATGTCAATTGTAAACTACCAGTATATCAT AGCTCCAATAAACCTTCAGTANAACAAACACCAACCGCATTGGCATTTTATATTCAGCAGTATATGAATAGTGGGAGTAG TGAATTAAGATCACTTTTGCATAAGGGTTATCCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_16: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146223384982AI067015EST208683Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146703385030AI067063EST208733Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148163385176AI067209EST208883Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 17:52:32 on Tue 21 Nov 117.