CShisMan2_1602


Sequence

>CShisMan2_1602 (2 EST) Length=277 AGGATTTATCAGCTCTTTACGAACCTATGGCAGTGAAGAGGAATATTTACAATAGAATAAGCCATCGTAAATTTAATAAA CGAGTTTTGAAAAGAGGTCCAGAAACACTTTGGGAACTGGACTAACGATCTATGGTCGAAAAAGATCAAATGAACTTATG TACATTTGTGTATGACATTTTTGTCTGTGATACACTGAAACAATTTTACGTTGACAGGAACTAATTTTTTGATTTGCGAT TTTGCAGTACAATAAAAGCAATAAATTATTAATCGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1602: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180211125910N20738SMNHADA007058SKSmAW
12098412330130AA559434MC260412.NA3TBRI-Saber-cercaria-A


Date: 16:21:43 on Sun 19 Nov 117.