CShisMan2_162


Sequence

>CShisMan2_162 (2 EST) Length=578 TGGAAACGTAATGATTTAAAACGTAGAGCTCAACTTTTCTAATTCTACTATTGACTAACCAGTTAATTGATTAATTGATT CATTTTTTTTGAAGAAGAGGAAACATTAAGTCAACTTACATTAAAACAACAAAATATTTTGGGAAAATAACTAAGATGAT TTATTCCTTTACAATTATGTTGAGTCTGTGTGTTTTTGTTGTTGAAATCTATACAGGAATCCGTTTGTTTGTTTGTTTGT TTGTTTGTGTCTAGTTGTCCAATTACATTCTGTTCAAAATTAAACGATTCAATCTACTACTAATAATAGTAAAAATATCG ATACATTTTACGGTTATCCCGGTCATTCTTAATTTCTTTATCTCTTACCTATTTATTATGTATTTTATCTTGAACAGTTA ATTATTTATTAATAGAATAAGACGAATATAATGACCTTCATTAAAATAAACAAAAACAAAATAACAATCGATTTAACATT GATCATCACTCTTTCGAAAATGTTTCAATTTAATTTCGTGTTATTAGTTCCCTTTAAAAATTGTGTATTTATTCATTTTA TTTTGGTTCTCCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_162: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147443385104AI067137EST208808Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152243385584AI067617EST209299Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:38:52 on Fri 17 Nov 117.