CShisMan2_1632


Sequence

>CShisMan2_1632 (5 EST) Length=330 CAGTGATAGGAAAACTCGAAATTGGGTAAAACTGGATCGACTTAACATACAAAAAGACAATAACCACAAAGAAAAAGTAT TATGCATGTATCCAGCAATAAATTAGGCTAACTCAAAATAGAATATGCATTCAAACGTCACAGATAAAACACATGACAAA CAGCTTGCTGATTTGCAGTTTTATATCACTTAGAAAAAGATGAAAATCAAAACGTACTAACCACGTCCAATATATGAGAA AAATTGGATTCGGCTGGACGTACATGATTTGGAATGGGCTGATCGGTTAAGTAGAAGGATAAATGAATATCACCACTGAG TGTAATTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1632: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
60714529744T24141SMEST0339Schistosoma mansoni, adult worm, Gloria Franco
7641951685511AA125692MLLG0264.M1FSchistosoma mansoni, lung stage
16629183080343AA931034SMTBADA000208SKSchistosoma Lambda Zap II
16716223098709AA938810SMTBADA000236SKSchistosoma Lambda Zap II
17371063190026AA999471MCCE3342.M1FSchistosoma mansoni, cercariae


Date: 2:41:5 on Sat 25 Nov 117.