CShisMan2_1636


Sequence

>CShisMan2_1636 (2 EST) Length=268 TACATATTATACAAATAATAGAAAATCATTTTTTTTCTAGAACAAGAAACACCTAAAGTACAACACTTTCTTCATCAAGG ATCCTCATTATACTTTTATTAGTACTATTATTATTATCAGTAATACTTTCACAAAAATATTTTTGCCTTCTAAGAAAAAG TTCTCTTCAATTCTTTTAAATGACATTGGTGTTTATGTAATAGCAGATTCATGCCGTGCATGATATATTTTGGTTTTTTG GAGGAATTATTTGGCAAACTGTCGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1636: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824361713274AA143869MCCE0252.M1RSchistosoma mansoni, cercariae
7824371713275AA143870MCCE0253.M1RSchistosoma mansoni, cercariae


Date: 16:21:23 on Fri 17 Nov 117.