CShisMan2_1643


Sequence

>CShisMan2_1643 (2 EST) Length=264 AGAGACAGGGTGCCTGACCCATGGTCAACTGCTGTTCCCATGGAACCCTTCTCCACCTCGGCCTTCAAGGTTCTCACTTG AATATTTGCTACTACCACCAAGATCTGCGCCTGTGGTTGCTTCACCTAGGCTCACGCCTGAGGCTTCCCGCTAGCCACAG CGACCCTCCTACTCGTTGCCGTCACTCCATGCCTAGACCAAGTGCAGCTTGCCCTCACACAGCATAGGCCTAGCTTACAG CAACGGTCCGGTATAGGTCCAACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1643: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151813385541AI067574EST209256Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151903385550AI067583EST209265Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 4:20:3 on Mon 20 Nov 117.