CShisMan2_1655


Sequence

>CShisMan2_1655 (2 EST) Length=269 ACATCGTCTGAATTTATTCCATCTTTACACCACTTAAGATCATTTACATTCTGGTACTGCAGGAGTGACTTCAGGTTGAA CGTTTTTGTTCCCGCGTTTATTATGCTTTTTGGCAAACCTCATATTCCTTAGGAATTTAGGGTCAACGCCTTTAAGTGAT GGGTATCGCTGTTTCTTTGGTTTATGGATCCCATTACGGTGCTGCTTTCGATTTTGATTATGACTAGTATGATTCTTGCT CTTCGCCATATCACACTACTGTAAGTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1655: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192301128081N21948SMNHADA020064SKSmAW
18151983385558AI067591EST209273Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 0:50:20 on Thu 23 Nov 117.