CShisMan2_166


Sequence

>CShisMan2_166 (2 EST) Length=571 GAATCAAAATAATCTCCATGTGAGAGTACTCTTGCATCATAATCTCACATTGTTTGTAAGTCCTTTTATCCTAAATGGAC GCGGTACACAGTGGGGATGAGTGGAGTATCGGTGGTGAATTGGAATTGGCTCAAGACTTCGAAGTCATCGATCTAAATGA ATTGGATTCTAGTTGTGGTTATATTTCGGAAGCAGATGACTCAACATATATCTCTTCGTTTCTTAATGGTCTCGTAACTG ATGAAACTCTTTATTCACGATATTTGAATGGGGTTATCAGTTTTGATGATTTAATGCGTGAAATGCACCACTCTACTACT CTGGACAATGATTCTTGCCGCAGTAGTGATTCAGATTGTTCTAGCAAAAATGACGATTCTGAATATACTATACGACCTAG AAGATCTAAAAGACGACAAAATCCTGATACAGTCGGAAAGAAAAAACTGAAATTAAGAGGACCTCTTATTTCTAAACGTG CTCGCTTACCAATTGAGTTAGCGCAATATCTTGGAGAAGCTGAGAGACATTTTAACAATGATGAATTTGAACACGCTGAA CGTATTTGCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_166: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148373385197AI067230EST208904Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150093385369AI067402EST209083Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:9:13 on Fri 24 Nov 117.