CShisMan2_1670


Sequence

>CShisMan2_1670 (4 EST) Length=325 TAAGTAGGGGAATATATATGTATTCCGTAAGCAGCCGAGTACAAGCAATCAAATAAGGGAAAAAGTCAAGCGCATTTATA CAGTAACAAATTGTCCTTGAGCATCATCAGTAAATAGCACACATAAAGAAACAAAGGACCAATAGCGGTTAAGATAGTTT ACAGGTGGGAAATATGACGCGAAGGTAAAAAGAGCGCGTTTGGCGCGAAAACAGCTAAATTCAAATTTTCAAAATAAAAC TACAAGATTAAGCCATTTACCAAGTAAGTTGTTCTGGGATTTGACATCCCAACACCTCCCGCGCTTTTAAGAAACTCGAG CTCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1670: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350217988848H49007EST000101S. mansoni cDNA
17368983189818AA999263MCCE3060.M1FSchistosoma mansoni, cercariae
17369573189877AA999322MCCE3136.M1FSchistosoma mansoni, cercariae
17369703189890AA999335MCCE3158.M1FSchistosoma mansoni, cercariae


Date: 0:48:51 on Wed 22 Nov 117.