CShisMan2_1679


Sequence

>CShisMan2_1679 (3 EST) Length=429 AGCATAAGAACAGTAAATTATTGTTATAATCAGCATCATTGTTTCTTTATAATAACGATTAATAATATTAATATTAAACA ATTAAGTGACCAAAATGATTTGATTTTCATCGATAAAAAAATAAGACAAGATTATAAGCATGTTGTATGCTGTAGCACAG CAAAGCTGATACCAAATATGTTTTTTTTGCTTTTTAAACAAATGAATCCATTACTTGGAAACAAGAAAAGAAACTGTTCA TTATTTAAATAAGCATTGAAGTTAAAATTAATAAAAAGAACATGACGATTTAAAAAAAGGTATTCCAATCATTCACTCAA TAGTAACGAACTAGTTAGCTGGGTGTTAAAGCAATGAAAAGAAAAGAAAACATCGACTTGTTATTCATCGTAATGATATG CTTTTGTCCTGGTACAAAACATTCGGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1679: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344871975927R95557SMNHADA007070SKSmAW
11587202252897AA514093MA2MA105.AA3S. mansoni adult Lambda Zap
17369563189876AA999321MCCE3135.M1FSchistosoma mansoni, cercariae


Date: 11:58:48 on Mon 20 Nov 117.