CShisMan2_168


Sequence

>CShisMan2_168 (4 EST) Length=635 TTCGTTTATTAGGAGGAAGATCTTGNAAGTTTCTTCAAGCCGTTTAACCGAAACATTAACAAAGTTGGAGGAGGCAAGTA AAACTGCAGAGGAAAGTGAACGTGGACGAAAAGACCTTGAGATTCGTTCGATTGCTGATGATGAGCGGCTTAACCAGCTG GAGGACCAACAAAAGGAAGCCAAGTATATTGCCGAGGATGCAGACCGTAAATATGACGAGGCTGCACGTAAATTAGCTAT CGCAGAAGTTGATTTTGAACGTGCGGAAGCTCGTCTCGAAGCTGCAGAAAGCAAAATAGTAGAATTGGAAGAGGAACTAC GAGTTGTTGGTAATAATATGAAAGCTCTTGAGATTTCCGAACAAGAGTCAGCCCAACGTGAAGAAAGCTATGAGGAAACA ATTCGAGATTTAACAGAACGATTGGAAGGCTGCTGAGCAAAGAGCAACTGAAGCTGAACGTCAAGTATCTAAACTACAAA ATGAGGTTGATCATTGGGAAGATGACTTATTGGCTGAGAAAGAACGATACAAGGCTCTTAGTGGCGAACTGGATCAAACT TTCGCAGAACTTACTGGTTATTAATAACACAATCAGGATATTCATTACCATTATCTTCATTTNCAGAGGACGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_168: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344875975931R95561SMNHADA007077SKSmAW
344941975997R95512SMNHADA018019SKSmAW
5679231366671W59933EST000452S. mansoni cDNA
12100482330337AA559641MC090746.NA3TBRI-Saber-cercaria-A


Date: 0:42:38 on Wed 22 Nov 117.