CShisMan2_1681


Sequence

>CShisMan2_1681 (2 EST) Length=261 ATTAAATTATACTCTTGTTCAATGTACTCAATATACTTCTGCATTAACAACTAGCATTTTAGGTGTAATTAAAAATATAT TGGTAACCTATGGTGGGATGTTTGTTGGTGGTGACTATGTGTATACGAGCCTAAATTTCGCTGGCCTTACTATAAGTACT ATTGGAGCAGTCTTATATGTTGTTTACAACTACAAATCTACACAATATAAATGTTTACCAACAAAATCAAGAACTTTAAT TGGCTAATGGAAAGTTGCTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1681: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17609573237178AI021766ME0042.R1RSchistosoma mansoni, egg stage
17609583237179AI021767ME0048.R1RSchistosoma mansoni, egg stage


Date: 14:35:12 on Sun 19 Nov 117.