CShisMan2_1682


Sequence

>CShisMan2_1682 (4 EST) Length=297 ATTGTATTATCATTATTTTCAAATGTTACAGTTGCTTTCANTTCNTTTTGATCTTTATATTTTTCATGTCCCATGTGATT TAGCATTAAGATTAAATTTAGCTCGTCCATGGTTATATTTTGATAATGTTTCATTAAACCTTCTGTATCATAAGTTGAAA AATATTTTGGTTTACCAGATTTTGTAGATATACTACCTTTATGAAATGTTGTTGTTAATTCATAATCAGATCCTTGATAT GTATCAGTGAAACCAAATAATTCACCAACAGCTTTTATATGTTTTTCACCATGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1682: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3644501017377H63031EST000301S. mansoni cDNA
4180261125915N20743SMNHADA007068SKSmAW
4350591154083N33684SMNHADA017093T3SmAW
16715913096895AA938784SMTBADA000301SKSchistosoma Lambda Zap II


Date: 14:28:34 on Fri 17 Nov 117.