CShisMan2_1690


Sequence

>CShisMan2_1690 (2 EST) Length=264 ATTCTAAATAAAACTCATTCCGTAGGAAAATCTATCATAACTGAAACGTGTACGGAGTCACTTGTATTCGATTTTTCTCA TTTATTGCATCCTGTATTGTCTTTCTTAGCCCTCAACTATGAGTTTCGACTTCTGCCTATTTCTTTCTGGTAACGCCTGC GCCATGCATTAAATTTCTGCTTTAAATACGCTTTCCCATTGACCCAATGGAGATGGATTACATATACAAGCATGTAGACA AAGATAAATATTTTGCTAATATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1690: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
60722529752T24149SMEST0347Schistosoma mansoni, adult worm, Gloria Franco
8733251858037AA233967SMIPADA000058M13RSchistosoma mansoni adult worm Lambda ZAP II library


Date: 15:7:25 on Fri 24 Nov 117.