CShisMan2_170


Sequence

>CShisMan2_170 (2 EST) Length=763 CGCCGGGTATTTGAGGCGTCATGATTTTCTGTTAATCAGAATTAGCATTAATCCACTTGGCGATCGAATCGTGAATGAAT TCTTTAAAGATAGTCAAGGTGAATTAAATTTTCGTCAATTTGTACGTAAATTAGCAAGATTTCGTAAAGTTCGACCTCAA CAATCAACTCAATTTAAATAATCGTGATGCAAAATTACGATTTCTATTCGGTATGTATGATTTAGATATGGATGGTAAAA TATCAAGAAATGAATTATTGGGAATGTTACAAATGATGGTTGGTGCTAATATTACTGTTGAACAGATCAATAATATTGGT GAAAGAACAATGGCTGAAGCGGATCTTGATGGTGATTGTTATATATCTTATGCGGAATTTGTACAAGCATTTGACAATGT GGATATTGAACAAAAGATGAGTATACGGCTTCTTGGAATGATTACACCGATCGATATATGTATATCTATCTTTATCCTCC TGTTGTTATACACACACACACACACACCAAAACTCGCAACAATTCCAATTATGAACTAAATCACTTCTTATCAATGATTT TCTTGTCGTTCAACTTTCTTTTCTGTATTCACTTCATTTACACAATGCTCAACTGTTTGTGCACATATAAATATTATTAT CTTGATCCTATGATCGACGTTTTAGTTTTGAATAGTTAGTTGTGTATGTGTTGCTATACTTCTCAATTATCCTCTTGTGA ACACATAAAGAGAGGCATGAAATGCACAGGCATACTACACATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_170: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8248361769687AA185771MAAD0179.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
11826412160098L81235SCMRAP0354C2/S1 day seven schistosomula mini-library


Date: 7:30:28 on Sun 19 Nov 117.