CShisMan2_171


Sequence

>CShisMan2_171 (7 EST) Length=774 AGACAAAAATTGAGTTACGGATAATTTACAATGAATGAAAACAAATTTGCCGCAATTGAAATNGAGGAAGTATAGGTTGA AACCAGGAGAGAAAACAAAAGTAATCAAAGAGGTTGTGCATGCTAAAAAAAAAACACTTACACAACATGCATACACATCC TCATTACAAATGCATAAACATCAGTAACTCATATGTGTACATACATAATATATATGTTGAGATGATAGGGTTTGTCCCTT CAAAAAAATAAGCCAACATCAAGGAACCAAAGATAATTCGGTTAATTAACCCATTAGACAACTACTTTTTTATTTAATGA TTAGATTTGAAAATTACATGTAAACTGCAAAACAAAACAAAACAAAACCGATGATCAAAACAAATTGACAAAAAGGGGAA CATGTTGCTGTACTGGCAAATGTAGACGTGTGTGTGGGGGGGGGATGGGTTTCACATAGAAACAAAAAAAGATTATAAGA TGAACAACACTATTNTACATTGTGAGTTTACATTGTAAGAAGTGAATAAGAAGAACTAAGTCAAAAACAATTATGAAATG AAATCCAACTTAATCCAACGTTAATTAATTTGAAATGATCTTTTGTACAGTTGGTTCAGCAATTAAAAAACGTAGNATAT CCGATAATGAAACAATACCTAATACTTTATTATCATTGACAACTACTAAACGATGTACACCAGCGTCAACAATTCTATTC ACAATCACTTCCAATGTATCATCTAACTGACATGTTGCAACACCTTGAAATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_171: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098492330138AA559442MC260427.NA3TBRI-Saber-cercaria-A
18693993509800AI111112MF004A11.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694043509805AI111117MF004A06.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694213509822AI111134MF003G11.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694533509854AI111166MF003E03.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694883509889AI110919MF003B02.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695783509979AI111009MF002B04.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 12:2:29 on Thu 23 Nov 117.