CShisMan2_1714


Sequence

>CShisMan2_1714 (2 EST) Length=260 GGTTAAAATTAATATGTTTTATTATCATTTATCAACAGATTATGCAATTAAGCAATAATTAATGAATATGAATACAGTTT AAAATGACTGAATGTTATCTTATTTGAATTTGGAAGGACACGAACATCCACACGTACACCCAGAACAATGACATTGACCA GATGGACAATCACATCCATTACCCGATGCACATCCAGAACAGCATTTACAGTTTCCACCACCACCACAACAACCTGGCAT GATATTGCCTCGTGNCGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1714: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350216988847H49006EST000097S. mansoni cDNA
4189971126884N21714SMNHADA00E004SKSmAW


Date: 2:47:34 on Mon 20 Nov 117.