CShisMan2_1719


Sequence

>CShisMan2_1719 (2 EST) Length=301 GGGACTAAAAGGCTTTGAAAATGGCTAAAAATCTATCTACCTAAAATGATAATCCATTTACTGTTGAAAATGGATTGTTA ACTCCGCACCATGAAAATATCACGCTCAAAATGACCCGTTCGACACTTTCAATCTATCGTTGAATCATTATATTTGGAAA CATGTTCTGAAGGCCAATGCCATAAGTAACAATTGTTAATTAGTAGCTCAATTTGTCCCACTGCCATTGTTTACTATCTT TAGCCAAAAAAATACACTCACATAGGCAATCATCGTTGTTGCTACATAAAAAATACAGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1719: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713831855038AA232039SMIPADA000041M13RSchistosoma mansoni adult worm Lambda ZAP II library
9102401906704AA269237MA1AS006.AASS. mansoni adult Lambda Zap


Date: 13:26:3 on Fri 24 Nov 117.