CShisMan2_1725


Sequence

>CShisMan2_1725 (3 EST) Length=256 TAACTTTTAAACATGTTTAAAAGGGATGATATATTATCGTCTAATTGACCAAGCTCTTTAAGAAGACTTTTATCACGTTC AGTTAATTCATTAGAAACACCTTCAGTTGATATTTGAAGCACGACGATGAATCATTTTCTTTATCAAGATGGTAAAAATT TTCCAATTTATACATAGTATCCGTATGTGCAAAGTTAATCGAACTTGGTATTAAACGATCCAGTTTATACATGATTCATG TAAACAACAAACCTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1725: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291721145898N28042EST000229S. mansoni cDNA
9100471906112AA269080MA1MA015.AA3S. mansoni adult Lambda Zap
9102481906712AA269245MA1AS014.AASS. mansoni adult Lambda Zap


Date: 18:16:5 on Fri 17 Nov 117.