CShisMan2_1730


Sequence

>CShisMan2_1730 (2 EST) Length=253 ACTAGCTAATATGGTGTTGTTCGATAACGCAACTTTTGAAAAGCTGCTAAAAGAAGTTCCTCAGTACAAGGTTATAACAC CTTCCGTTGTGTCAGAACGATTAAAAATTCGGGCGTCTCTGGCACGTCATGCTCTCGAGGAGCTGTGGCGACGAGGTTCC ATAAAAATGGTCTGCAAACATAATTCACAGCAGATATACACAAGAACAACAAAGACCGACTAATTGTACAATTATATGTA TTGGGACACAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1730: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344802974659L47062SCMRAP149C2/25RY adult worm mini-library
4236441139745N25397EST000093S. mansoni cDNA


Date: 19:17:5 on Wed 22 Nov 117.