CShisMan2_1742


Sequence

>CShisMan2_1742 (2 EST) Length=255 AAGCTTGGTACCGTGACACCGTAGNAATACACCGCCGTGGGAAGGCGTTAACTATTTATTGACATAAATATCCAGTCGCA TGTCGAAACGCTCTGGCTTAGGTGTGATCACCAGCGAAGAGTTATCAAAACCTTTGAAATTGTCAAAACCATCTTTGGAC AGTAATGAAGAAGACTATAACGATAAAGATTGTTTCCGATTACATGAAGCGGATATAGATGGTCAGGAAGCTACGACTTT AGAGTATGATGATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_1742: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39355514749T14582SMEST0243Schistosoma mansoni, adult worm, Gloria Franco
39416514810T14643SMEST0304Schistosoma mansoni, adult worm, Gloria Franco


Date: 2:39:1 on Fri 24 Nov 117.